View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1408_low_269 (Length: 208)

Name: NF1408_low_269
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1408_low_269
NF1408_low_269
[»] chr7 (1 HSPs)
chr7 (1-121)||(6705682-6705802)


Alignment Details
Target: chr7 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 121
Target Start/End: Complemental strand, 6705802 - 6705682
Alignment:
Q  1 aacatcaacatctagtaccacataactgggcatttggtccattattaccacactcaatggcaattaatatgccttcttctacagcttatgttccatcttc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||    
T  6705802 aacatcaacatctagtaccacataactgggcatttggtccattattaccacactcaatggcaattaatatgccttcttctacatcttatattccatcttc 6705703  T
Q  101 ttctttatcacaatcttgttc 121  Q
    |||||||||||||||||||||    
T  6705702 ttctttatcacaatcttgttc 6705682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University