View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1408_low_193 (Length: 248)

Name: NF1408_low_193
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1408_low_193
NF1408_low_193
[»] chr8 (1 HSPs)
chr8 (1-129)||(27066833-27066961)


Alignment Details
Target: chr8 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 1 - 129
Target Start/End: Complemental strand, 27066961 - 27066833
Alignment:
Q  1 ccgccgcccatctcttctgcttcccggaactcacaaaacaacgtcctttcgacccctcacatttcactgtctacgaaactgaccagaatttcaccttcta 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  27066961 ccgccgcccatctcttctgcttcccggaactcacaaaacaacgtcctttcgacccctcacatttcactgtctacgaaactgaccagaatttcaccttcta 27066862  T
Q  101 cagcctcggagagaatttcaccacctatg 129  Q
    |||||||||||||||||||||||||||||    
T  27066861 cagcctcggagagaatttcaccacctatg 27066833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University