View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1408_high_182 (Length: 219)

Name: NF1408_high_182
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1408_high_182
NF1408_high_182
[»] chr7 (2 HSPs)
chr7 (1-105)||(1481018-1481122)
chr7 (15-63)||(1480984-1481033)


Alignment Details
Target: chr7 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 1 - 105
Target Start/End: Original strand, 1481018 - 1481122
Alignment:
Q  1 tagcctttcttgagtttagtataagaaagctcgcgaaaaaagacttttagcctttcttgagttgtatgtgttatgtactatggagtattaagtatgtgat 100  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||    
T  1481018 tagcctttcttgagtttagaataagaaagctcgcgaaaaaagacttttagcctttcttgagttgtatgtgttatgtactacggagtgttaagtatgtgat 1481117  T
Q  101 gatgt 105  Q
     ||||    
T  1481118 aatgt 1481122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 15 - 63
Target Start/End: Original strand, 1480984 - 1481033
Alignment:
Q  15 tttagtataagaaagctcgcgaaaaa-agacttttagcctttcttgagtt 63  Q
    ||||||||||||||||||| |||||| |||||||||||||||||||||||    
T  1480984 tttagtataagaaagctcgtgaaaaacagacttttagcctttcttgagtt 1481033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University