View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1408_high_142 (Length: 248)

Name: NF1408_high_142
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1408_high_142
NF1408_high_142
[»] chr8 (3 HSPs)
chr8 (1-110)||(27066937-27067046)
chr8 (13-112)||(27080633-27080732)
chr8 (1-71)||(27053748-27053818)


Alignment Details
Target: chr8 (Bit Score: 106; Significance: 4e-53; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 1 - 110
Target Start/End: Original strand, 27066937 - 27067046
Alignment:
Q  1 gggaagcagaagagatgggcggcggagcagaactccggcagctttgtggagagtgtgttggcggccgcgtgttttgtgaatgtcgcggcttcggtggcgc 100  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  27066937 gggaagcagaagagatgggcggcggagcagaattccggcagctttgtggagagtgtgttggcggccgcgtgttttgtgaatgtcgcggcttcggtggcgc 27067036  T
Q  101 tgagtggtga 110  Q
    ||||||||||    
T  27067037 tgagtggtga 27067046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 13 - 112
Target Start/End: Original strand, 27080633 - 27080732
Alignment:
Q  13 agatgggcggcggagcagaactccggcagctttgtggagagtgtgttggcggccgcgtgttttgtgaatgtcgcggcttcggtggcgctgagtggtgatg 112  Q
    |||||||| || |||||||||||||||| ||||||||||||||||||||| ||||||||||| |  || | |||||  ||||||||||||||||||||||    
T  27080633 agatgggcagccgagcagaactccggcaactttgtggagagtgtgttggctgccgcgtgtttcgcaaaagccgcggtctcggtggcgctgagtggtgatg 27080732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 71
Target Start/End: Original strand, 27053748 - 27053818
Alignment:
Q  1 gggaagcagaagagatgggcggcggagcagaactccggcagctttgtggagagtgtgttggcggccgcgtg 71  Q
    ||||||||||||||||| ||||| |||||||| ||||||| ||||||||| | |||||||||||| |||||    
T  27053748 gggaagcagaagagatgtgcggcagagcagaattccggcaactttgtggataatgtgttggcggcagcgtg 27053818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University