View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1408_high_139 (Length: 250)

Name: NF1408_high_139
Description: NF1408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1408_high_139
NF1408_high_139
[»] chr1 (1 HSPs)
chr1 (30-246)||(26988606-26988822)


Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 30 - 246
Target Start/End: Original strand, 26988606 - 26988822
Alignment:
Q  30 atactgaagtgaatccggcgaaaccttcaacctcggagaagccaccgccgccgccggagactcaacaaaaggaacagaaaccatttcaacgggtttggag 129  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||    
T  26988606 atactgaagtgaatccggcgaaaccttcaacctcggagaagccacagccgccgccggagactcaacaaaaggaacagaaaccatttcaacaggtttggag 26988705  T
Q  130 acagcggcggcggtagttgttacgaatggtttgaaacgagggttagggtgaagagtagtgtgctgcattatgtggcggtggttacggaggaggaggggag 229  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||| |||    
T  26988706 acagcggcggcggtagttgttacgaatggtttgaaacgagggttagggtgaagagtagtgtactgcattctgtggcggtggttacggaggaggaggtgag 26988805  T
Q  230 ggtgtggctgtgataat 246  Q
    | |||||||||||||||    
T  26988806 gttgtggctgtgataat 26988822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University