View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14061_high_23 (Length: 244)

Name: NF14061_high_23
Description: NF14061
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14061_high_23
NF14061_high_23
[»] chr2 (1 HSPs)
chr2 (26-228)||(5386019-5386221)


Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 26 - 228
Target Start/End: Complemental strand, 5386221 - 5386019
Alignment:
Q  26 agggaccaacaaaataattaaacctattgtaaatatagaactcatgtagttgaaaatttcccttaaaaatacttactgtcgaaaacttgaagggaatatt 125  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  5386221 agggaccaacaaaataattaaacctattgtaaatatagaactcatgtagttgaaaatttcccttaaaaatacttactgtcgaaaacttgaagggaatatt 5386122  T
Q  126 ataaaatgggattnnnnnnntctcatgagagtcttatatttagggatgcagcagcaaaatttaattattatccatgagaaatataaatcaacacattctt 225  Q
    ||||||||||||        ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  5386121 ataaaatgggataaaaaaaatctcatgagagtcttatatttagggatgcagcagcaaaatttaattattatccatgagaaatataaatcaacacattctt 5386022  T
Q  226 ttt 228  Q
    |||    
T  5386021 ttt 5386019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University