View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14060_high_30 (Length: 230)

Name: NF14060_high_30
Description: NF14060
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14060_high_30
NF14060_high_30
[»] chr7 (1 HSPs)
chr7 (139-223)||(48287271-48287355)


Alignment Details
Target: chr7 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 139 - 223
Target Start/End: Complemental strand, 48287355 - 48287271
Alignment:
Q  139 tttttatgttttgtttctacttgaaagtttacacattgaaatgggaccacccaatcaagattgaatagttcaaatcttaaaatag 223  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  48287355 tttttatgttttgtttctacttgaaagtttacacattgaaatgggaccacccaatcaagattgaatagttcaaatcttaaaatag 48287271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University