View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14058_high_16 (Length: 246)

Name: NF14058_high_16
Description: NF14058
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14058_high_16
NF14058_high_16
[»] chr7 (1 HSPs)
chr7 (8-139)||(43949716-43949847)


Alignment Details
Target: chr7 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 8 - 139
Target Start/End: Complemental strand, 43949847 - 43949716
Alignment:
Q  8 gagcagagagaatccggatctgtatttgcttttttactttagtgatttcccccaaaatagatccgttagtggttatcaaaatgatgaaaaataaacgtag 107  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
T  43949847 gagcagagagaatccggatctgtatttgcttttttactttagtgatttcccccaaaatagatccgttattggttatcaaaatgatgaaaaataaacgtag 43949748  T
Q  108 ataggtaagagaatagtgtcacaaggatacaa 139  Q
    ||||||||||||||||||||||||||||||||    
T  43949747 ataggtaagagaatagtgtcacaaggatacaa 43949716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University