View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1404_low_122 (Length: 305)

Name: NF1404_low_122
Description: NF1404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1404_low_122
NF1404_low_122
[»] chr6 (1 HSPs)
chr6 (30-296)||(4072319-4072586)


Alignment Details
Target: chr6 (Bit Score: 176; Significance: 8e-95; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 176; E-Value: 8e-95
Query Start/End: Original strand, 30 - 296
Target Start/End: Original strand, 4072319 - 4072586
Alignment:
Q  30 aactttgcatgcttctcattcaacttgtggcaccttctattattgtctaaaccatgttgtcgaaaccttataaacaaccaattaggatgaggatgaacac 129  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| || ||||| ||||||||||||||||||||||||||||||||    
T  4072319 aactctgcatgcttctcattcaacttgtggcaccttctattattgtctaaactatgttttcaaaaccctataaacaaccaattaggatgaggatgaacac 4072418  T
Q  130 cannnnnnnnnnnnnnnn-atcttcttgatagggtcgatcattaaaatctcctatgacacaccaatgaagcgaggacatatcacttaaactctcataaca 228  Q
    |                  |||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||    
T  4072419 cttttttttttttttttttatcttcttgatagggtcgatcattaaaatctcctataatacaccaatgaagcgaggacatatcacttaaactctcataaca 4072518  T
Q  229 aattacatgcctctcttcaacggttgcatagtggataaccataatagcatgttaacctccattctctc 296  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4072519 aattgcatgcctctcttcaacggttgcatagtggataaccataatagcatgttaacctccattctctc 4072586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University