View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1404_high_133 (Length: 214)

Name: NF1404_high_133
Description: NF1404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1404_high_133
NF1404_high_133
[»] chr4 (1 HSPs)
chr4 (3-117)||(19506483-19506597)


Alignment Details
Target: chr4 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 3 - 117
Target Start/End: Complemental strand, 19506597 - 19506483
Alignment:
Q  3 gtaactttaccaactttgatggcttttccttccttgtcaaaacatggttttgccgtaaaatatctgaagctgtagtctctgagactctcatatctcactg 102  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
T  19506597 gtaactttaccaactttgatggcttttccttccttgtcaaaacatggttttgccgtaaaatatctgaagcagtagtctctgagactctcatatctcactg 19506498  T
Q  103 gattcccaacagatg 117  Q
    |||||||||||||||    
T  19506497 gattcccaacagatg 19506483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University