View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14039_low_19 (Length: 261)

Name: NF14039_low_19
Description: NF14039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14039_low_19
NF14039_low_19
[»] chr5 (1 HSPs)
chr5 (13-248)||(8211940-8212175)


Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 13 - 248
Target Start/End: Original strand, 8211940 - 8212175
Alignment:
Q  13 aaaataagctcagtggaaaaatacctgatttgggttctcttgaaaatctttactacatggatcttagtaataatggattttccggtgacccgtttggatt 112  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  8211940 aaaataagctcagtggaaaaatacctaatttgggttctcttgaaaatctttactacatggatcttagtaataatggattttccggtgacccgtttggatt 8212039  T
Q  113 tccggcgtctttggttcagatttcaatgaggaacaataatttaagcggtggtttagcttctgaaagcttcaagaatttgaattatctgcaggttgtggat 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
T  8212040 tccggcgtctttggttcagatttcaatgaggaacaataatttaagtggtagtttagcttctgaaagcttcaagaatttgaattatctgcaggttgtggat 8212139  T
Q  213 ttcagttcaaacaaaattaatggctatgttccttct 248  Q
    ||||||||||||||||| ||||||||||||||||||    
T  8212140 ttcagttcaaacaaaatcaatggctatgttccttct 8212175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University