View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14031_high_36 (Length: 298)

Name: NF14031_high_36
Description: NF14031
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14031_high_36
NF14031_high_36
[»] chr4 (2 HSPs)
chr4 (1-286)||(48411844-48412129)
chr4 (1-252)||(48418433-48418687)


Alignment Details
Target: chr4 (Bit Score: 261; Significance: 1e-145; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 1 - 286
Target Start/End: Complemental strand, 48412129 - 48411844
Alignment:
Q  1 ttgagtgttcacttgagttggaatctttgaatttggatccagaaaatattgcacgtgttgttcccggaaggataacccaaatgcggttttgcccttccaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  48412129 ttgagtgttcacttgagttggaatctttgaatttggatccagaaaatattgcacgtgttgttcccggaaggataacccaaatgcggttttgcccttccaa 48412030  T
Q  101 tgatgttaagatggtggcagcgggtaacaaattcggggatattgggttctggaatgttggagaaagtgagannnnnnngtatcatccacatcaggctcct 200  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||    
T  48412029 tgatgttaagatggtggcagcgggtaacaaattcggtgatattgggttctggaatgttggagaaagtgagatttttttgtatcatccacatcaggctcct 48411930  T
Q  201 atttctgggatcttgtttcaaccgcattgcttatcaaaggtttgtgaattcttaatctcgatttctgaatcagtttgttatttttg 286  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  48411929 atttctgggatcttgtttcaaccgcattgcttatcaaaggtttgtgaattcttaatctcgatttctgaatcagtttgttatttttg 48411844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 1 - 252
Target Start/End: Complemental strand, 48418687 - 48418433
Alignment:
Q  1 ttgagtgttcacttgagttggaatctttgaatttggatccagaaaatattgcacgtgttgttcc---cggaaggataacccaaatgcggttttgcccttc 97  Q
    |||||||||||||||||||||||||||||  ||||||||   ||||||| ||||||||||||||   |||  | ||||| ||  |||| ||||  |||||    
T  48418687 ttgagtgttcacttgagttggaatctttgtctttggatcgtaaaaatatagcacgtgttgttcctgacggcggcataactcacttgcgatttttaccttc 48418588  T
Q  98 caatgatgttaagatggtggcagcgggtaacaaattcggggatattgggttctggaatgttggagaaagtgagannnnnnngtatcatccacatcaggct 197  Q
    ||||||| | |||||||| | ||| ||||||| | ||||||||||||||||||||||||||||||||||||||        ||| |||||||||||||||    
T  48418587 caatgatttcaagatggtagtagccggtaacagagtcggggatattgggttctggaatgttggagaaagtgaggtttttgtgtaccatccacatcaggct 48418488  T
Q  198 cctatttctgggatcttgtttcaaccgcattgcttatcaaaggtttgtgaattct 252  Q
    || |||||||||||||   |||| || |||||||| |||||||| ||||||||||    
T  48418487 cccatttctgggatctccattcacccacattgcttgtcaaaggtgtgtgaattct 48418433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University