View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1402_high_7 (Length: 415)

Name: NF1402_high_7
Description: NF1402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1402_high_7
NF1402_high_7
[»] chr5 (1 HSPs)
chr5 (13-241)||(41297454-41297682)
[»] scaffold0043 (1 HSPs)
scaffold0043 (189-238)||(55905-55954)


Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 13 - 241
Target Start/End: Complemental strand, 41297682 - 41297454
Alignment:
Q  13 aatatgttgtagcaatggaatcccaaactcctttggctgttgggaagcgaatgaaatatcccaccagcgaaggatccattgagtttatcagccgtccttt 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||    
T  41297682 aatatgttgtagcaatggaatcccaaactcctttggctgttgggaagcgaatgaaatttcccaccagcgaaggatccattgagtttatcagccatccttt 41297583  T
Q  113 cactatggcattctcagtccgccatttacgaaatgtcggatcagttgctgacggttgagggaaggttccgttaatatatcccagtttgtctttaactgag 212  Q
    |||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||  |||||    
T  41297582 cactatggcattctcagtccgcaatttacaaaatgtcggatcagttgctgacggttgagggaaggttccgtcaatatatcccagtttgtctttgcctgag 41297483  T
Q  213 atgtacatcttagccacctgggaccataa 241  Q
    |||||||||| ||||||||||||||||||    
T  41297482 atgtacatctcagccacctgggaccataa 41297454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0043 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0043
Description:

Target: scaffold0043; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 189 - 238
Target Start/End: Complemental strand, 55954 - 55905
Alignment:
Q  189 tatcccagtttgtctttaactgagatgtacatcttagccacctgggacca 238  Q
    |||||||||||||||||  ||||||| ||||||| | |||||||||||||    
T  55954 tatcccagtttgtctttgcctgagatatacatctcaaccacctgggacca 55905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University