View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14029_low_14 (Length: 256)

Name: NF14029_low_14
Description: NF14029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14029_low_14
NF14029_low_14
[»] chr3 (1 HSPs)
chr3 (16-156)||(288935-289075)
[»] chr7 (1 HSPs)
chr7 (22-77)||(21285811-21285866)


Alignment Details
Target: chr3 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 16 - 156
Target Start/End: Complemental strand, 289075 - 288935
Alignment:
Q  16 aatactagatggcttaattgtttgatgtactgtaaaaatattagttgcatttgtactcatgtcctcggagagggtaacctagttgctgacgctttggcaa 115  Q
    ||||| |||||| |||| ||||||| |||||||||||| |||| |||||||||||| ||||||||| ||||||||||  | || ||||| || || || |    
T  289075 aataccagatggtttaactgtttgaggtactgtaaaaacattacttgcatttgtacacatgtcctcagagagggtaatttggtagctgatgcatttgcca 288976  T
Q  116 agaatggccgagggctggctttgtactcttcacagcggtgg 156  Q
    ||||||||| |||| |||||||||| ||||||||| |||||    
T  288975 agaatggccaagggttggctttgtattcttcacagtggtgg 288935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 22 - 77
Target Start/End: Original strand, 21285811 - 21285866
Alignment:
Q  22 agatggcttaattgtttgatgtactgtaaaaatattagttgcatttgtactcatgt 77  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  21285811 agatggcttaattgtttgatgtactgtaaaaatattagttgcatttgtactcatgt 21285866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University