View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14026_high_9 (Length: 235)

Name: NF14026_high_9
Description: NF14026
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14026_high_9
NF14026_high_9
[»] chr3 (1 HSPs)
chr3 (1-101)||(46872349-46872449)


Alignment Details
Target: chr3 (Bit Score: 97; Significance: 8e-48; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 1 - 101
Target Start/End: Original strand, 46872349 - 46872449
Alignment:
Q  1 ctcgagactcttgttacaacgttgtacaaacacatacactacaccaatttatgtttttaccttaaaacaacaaaatgcacgtttagtttaaattacactc 100  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  46872349 ctcgagactcttgttacaacgttgtacaaacacaaacactacaccaatttatgtttttaccttaaaacaacaaaatgcacgtttagtttaaattacactc 46872448  T
Q  101 c 101  Q
    |    
T  46872449 c 46872449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University