View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14023_low_19 (Length: 371)

Name: NF14023_low_19
Description: NF14023
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14023_low_19
NF14023_low_19
[»] chr8 (2 HSPs)
chr8 (257-354)||(29235857-29235954)
chr8 (257-354)||(29280590-29280687)
[»] chr2 (1 HSPs)
chr2 (277-317)||(40030312-40030352)


Alignment Details
Target: chr8 (Bit Score: 94; Significance: 8e-46; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 94; E-Value: 8e-46
Query Start/End: Original strand, 257 - 354
Target Start/End: Complemental strand, 29235954 - 29235857
Alignment:
Q  257 aactgaattgcatgtgcattatcattgaactgtgtgaacaaagaggatggccaatacccaactatttcagttccatatccaaaccaccagttcccatt 354  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  29235954 aactgaattgcatgtgcattatcattgaactgtgtgaataaagaggatggccaatacccaactatttcagttccatatccaaaccaccagttcccatt 29235857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 257 - 354
Target Start/End: Complemental strand, 29280687 - 29280590
Alignment:
Q  257 aactgaattgcatgtgcattatcattgaactgtgtgaacaaagaggatggccaatacccaactatttcagttccatatccaaaccaccagttcccatt 354  Q
    |||| |||| ||||||||||||| || |||| ||||||||| || ||||||||||||||||||| ||||| |||||||||||||||||||||||||||    
T  29280687 aactcaatttcatgtgcattatccttcaactttgtgaacaaggaagatggccaatacccaactacttcagatccatatccaaaccaccagttcccatt 29280590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 277 - 317
Target Start/End: Complemental strand, 40030352 - 40030312
Alignment:
Q  277 atcattgaactgtgtgaacaaagaggatggccaatacccaa 317  Q
    |||||| || |||||||||||||||||||||||||| ||||    
T  40030352 atcatttaagtgtgtgaacaaagaggatggccaatatccaa 40030312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University