View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1401_low_97 (Length: 211)

Name: NF1401_low_97
Description: NF1401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1401_low_97
NF1401_low_97
[»] chr4 (1 HSPs)
chr4 (1-112)||(56492395-56492506)


Alignment Details
Target: chr4 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 56492506 - 56492395
Alignment:
Q  1 tcttgccaacggtgctgcacaactcagtccaccaataccactcccaatcacaattacatctgtttctgtttcatctactttgttgctgctgtttcgcacc 100  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  56492506 tcttgccaacagtgctgcacaactcagtccaccaataccactcccaatcacaattacatctgtttctgtttcatctactttgttgctgctgtttcgcacc 56492407  T
Q  101 acaaccccacct 112  Q
    ||||||||||||    
T  56492406 acaaccccacct 56492395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University