View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1401_low_56 (Length: 302)

Name: NF1401_low_56
Description: NF1401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1401_low_56
NF1401_low_56
[»] chr8 (1 HSPs)
chr8 (103-222)||(10247376-10247495)


Alignment Details
Target: chr8 (Bit Score: 92; Significance: 1e-44; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 103 - 222
Target Start/End: Complemental strand, 10247495 - 10247376
Alignment:
Q  103 ctaaccatgtaataatttgcaaatatccactgaaatagtcaatgaataagaatgtannnnnnnncttctgaccatataataattcgcaaatatccaccga 202  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||||||||||    
T  10247495 ctaaccatgtaatgatttgcaaatatccactgaaatagtcaatgaataagaatgtatttttcttcttctgaccatataataattcgcaaatatccaccga 10247396  T
Q  203 tgttgtcaatgataatctat 222  Q
    ||||||||||||||||||||    
T  10247395 tgttgtcaatgataatctat 10247376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University