View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14006_low_14 (Length: 286)

Name: NF14006_low_14
Description: NF14006
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14006_low_14
NF14006_low_14
[»] chr5 (1 HSPs)
chr5 (16-216)||(222450-222650)


Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 16 - 216
Target Start/End: Complemental strand, 222650 - 222450
Alignment:
Q  16 tgagatgaatcgaaaactacacaatcagtttaacaccgaagaagcttccacttcttgtgtgaaccctatattcgccggagtttcaatttttgtcgatggt 115  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
T  222650 tgagaagaatcgaaaactacacaatcagtttaacaccgaagaagcttccacttcttgtgggaaccctatattcgccggagtttcaatttttgtcgatggt 222551  T
Q  116 ttcaccgttccttccagtcaggaactgcgtggatacatgttaaagtatggtggaagatttgagaattatttctcaaggcatcgtgtaacacatatcatct 215  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  222550 ttcaccgttccatccagtcaggaactgcgtggatacatgttaaagtatggtggaagatttgagaattatttctcaaggcatcgtgtaacacatatcatct 222451  T
Q  216 g 216  Q
    |    
T  222450 g 222450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University