View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13991_high_12 (Length: 207)

Name: NF13991_high_12
Description: NF13991
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13991_high_12
NF13991_high_12
[»] chr4 (1 HSPs)
chr4 (29-190)||(4725611-4725773)


Alignment Details
Target: chr4 (Bit Score: 87; Significance: 7e-42; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 29 - 190
Target Start/End: Complemental strand, 4725773 - 4725611
Alignment:
Q  29 tatatcataaggtgggaactgggaaatatgaaatgttgcnnnnnnnnntctcatcaaataatgttgcaacttaaatttagttccatgtcnnnnnnnnnn- 127  Q
    |||||||||||||||||||||||||||||||||||||||         |||||||||||||||||||||||||||||||||||||||||               
T  4725773 tatatcataaggtgggaactgggaaatatgaaatgttgcaaaaaaaa-tctcatcaaataatgttgcaacttaaatttagttccatgtcaaaaaaaaaaa 4725675  T
Q  128 -cttaaatttagtgtatatatatgtacctcaataaaatagttaagataaattggtgtttggaga 190  Q
     |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
T  4725674 acttaaatttagtgtatatatatgtacctcaataaaatagttaagataaattggtgtatggaga 4725611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University