View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13987_high_14 (Length: 252)

Name: NF13987_high_14
Description: NF13987
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13987_high_14
NF13987_high_14
[»] scaffold0050 (1 HSPs)
scaffold0050 (6-69)||(72533-72596)


Alignment Details
Target: scaffold0050 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: scaffold0050
Description:

Target: scaffold0050; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 6 - 69
Target Start/End: Original strand, 72533 - 72596
Alignment:
Q  6 agtgagatgaacagcttcaagaaattataacattttatgtaaaaaatttcatcaagtaatgggg 69  Q
    ||||| ||||||||||||||||||||||||||||| ||||||||| | ||||||||||||||||    
T  72533 agtgacatgaacagcttcaagaaattataacatttcatgtaaaaattgtcatcaagtaatgggg 72596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University