View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13984_low_47 (Length: 216)

Name: NF13984_low_47
Description: NF13984
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13984_low_47
NF13984_low_47
[»] scaffold0024 (1 HSPs)
scaffold0024 (17-155)||(12975-13113)


Alignment Details
Target: scaffold0024 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: scaffold0024
Description:

Target: scaffold0024; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 17 - 155
Target Start/End: Complemental strand, 13113 - 12975
Alignment:
Q  17 caaaggaaatgagagattcagataacttagaataccattgtctacttgcctgcttgaggccatatatagatttttgaagcttacataccttggttgttct 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
T  13113 caaaggaaatgagagattcagataacttagaataccattgtctacttgcctgcttgaggccatatatagatttttgaagctcacataccttggttgttct 13014  T
Q  117 agtatcggaattagagattttaatactagagggcaaaga 155  Q
    |||||||||||||||||||||||||| || |||||||||    
T  13013 agtatcggaattagagattttaataccagggggcaaaga 12975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University