View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13980_low_3 (Length: 229)

Name: NF13980_low_3
Description: NF13980
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13980_low_3
NF13980_low_3
[»] chr1 (1 HSPs)
chr1 (31-211)||(28022775-28022955)


Alignment Details
Target: chr1 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 31 - 211
Target Start/End: Original strand, 28022775 - 28022955
Alignment:
Q  31 gagatgaaacagaaacagttactctcattgttgatccactgccatcagacctgaaactacatgttttagtgaagtttcttggccatggcagcaatggcta 130  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  28022775 gagatgaaacagaaacagttactctcattgttgatccgctgccatcagacctgaaactacatgttttagtgaagtttcttggccatggcagcaatggcta 28022874  T
Q  131 tgtgagggtgaaggagaccgataaggtgagtgacctgtgcgacaaagtttcacgatattggggcattccccttgatacttt 211  Q
    |||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||    
T  28022875 tgtgagggtgaaggagaccgataaggtgagtgacctgtgcaacaaagtttcacggtattggggcattccccttgatacttt 28022955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University