View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1397_low_10 (Length: 204)

Name: NF1397_low_10
Description: NF1397
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1397_low_10
NF1397_low_10
[»] chr7 (1 HSPs)
chr7 (1-61)||(27154627-27154687)


Alignment Details
Target: chr7 (Bit Score: 57; Significance: 5e-24; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 27154627 - 27154687
Alignment:
Q  1 tccttgctacaccatagaaacaatgctcactccccagtttgctctcggtgtggtctctctg 61  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
T  27154627 tccttgctacaccatagaaacaatgctcactcccaagtttgctctcggtgtggtctctctg 27154687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University