View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13977_high_5 (Length: 215)

Name: NF13977_high_5
Description: NF13977
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13977_high_5
NF13977_high_5
[»] chr8 (1 HSPs)
chr8 (1-191)||(40368033-40368220)


Alignment Details
Target: chr8 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 191
Target Start/End: Complemental strand, 40368220 - 40368033
Alignment:
Q  1 tgacaagtttcttatgcgttaagcatagcaagcccttttctgctgcttttgttggtaaacaaaaaagcacaacccactttggcgtagaatttatgaacat 100  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||    
T  40368220 tgacaagtttcttatgcgttaagtatagcaagcccttttctgctgcttttgttggtaaaca-aaaagcacaacccactttggcatagaatttatgaacat 40368122  T
Q  101 caaaataactaatccaagnnnnnnnnnntaaggattgtttatagtagaggatcaaaggctccacaaaagaggagggaaaacactacattat 191  Q
    ||||||||||||||||||          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40368121 caaaataactaatccaag--aaaaaaaataaggattgtttatagtagaggatcaaaggctccacaaaagaggagggaaaacactacattat 40368033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University