View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13975_low_90 (Length: 242)

Name: NF13975_low_90
Description: NF13975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13975_low_90
NF13975_low_90
[»] chr8 (3 HSPs)
chr8 (1-74)||(44326669-44326742)
chr8 (86-151)||(44326617-44326682)
chr8 (163-229)||(44326489-44326555)


Alignment Details
Target: chr8 (Bit Score: 66; Significance: 3e-29; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 74
Target Start/End: Complemental strand, 44326742 - 44326669
Alignment:
Q  1 tcaagtcttttgttgattattgattttggtgtgttcggtctaaagatatattttgattgagggactaaattgtt 74  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||    
T  44326742 tcaagtcttttgttgattattgattttggtgagttcggtctaaagatatattttgattgcgggactaaattgtt 44326669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 86 - 151
Target Start/End: Complemental strand, 44326682 - 44326617
Alignment:
Q  86 gggattaatttgttattgagggattaaattgctcaaactttacaacataccaatttagttccttta 151  Q
    |||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  44326682 gggactaaattgttattgagggattaaattgctcaaactttacaacataccaatttagttccttta 44326617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 163 - 229
Target Start/End: Complemental strand, 44326555 - 44326489
Alignment:
Q  163 ttgcaaagttgccactaccattttcaactttatgttcttattcaagttaatatggaagtcttatatt 229  Q
    |||||||||||||||||||||||||||| |||| | |||||||||||||||||||||||||||||||    
T  44326555 ttgcaaagttgccactaccattttcaacgttatatgcttattcaagttaatatggaagtcttatatt 44326489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University