View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13975_low_102 (Length: 233)

Name: NF13975_low_102
Description: NF13975
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13975_low_102
NF13975_low_102
[»] chr1 (1 HSPs)
chr1 (68-185)||(47560740-47560857)


Alignment Details
Target: chr1 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 68 - 185
Target Start/End: Original strand, 47560740 - 47560857
Alignment:
Q  68 aaattcaaaaagctcaaagagaactcagatttactataagaaggatattgttggagtgttgatgtaaacaaataatctactagttgtcggaagaagatgt 167  Q
    |||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||    
T  47560740 aaattcaaaaagctcaaagagaactcagatttgctagaagaaggatattgttggagtgctgatataaacaaataatctactagttgtcggaagaagatgt 47560839  T
Q  168 gtttcagtgttgattttg 185  Q
    ||||||||||||||||||    
T  47560840 gtttcagtgttgattttg 47560857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University