View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13972_low_6 (Length: 239)

Name: NF13972_low_6
Description: NF13972
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13972_low_6
NF13972_low_6
[»] chr3 (1 HSPs)
chr3 (1-221)||(32424195-32424409)


Alignment Details
Target: chr3 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 32424409 - 32424195
Alignment:
Q  1 tggaacacattgttatattcattaaccacatatgtgaaccatgtcagccatctagattattgtggaattttgatgtaaattggtgtatcaaaatataaat 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  32424409 tggaacacattgttatattcattaaccacatatgtgaaccatgtcagccatctagattattgtggaattttgatgtaaattggtgtttcaaaatataaat 32424310  T
Q  101 tctattatgtaacatcatatatattccaatagaacacaatgataacatactatactcttcattagagtgatttaattgatctataaagggttatatggtt 200  Q
    ||||| ||||||||||    |||||||||||||  ||||||||| | |||||| ||||||||||||||||||||||||||||||||||||||||||||||    
T  32424309 tctatcatgtaacatc----atattccaataga--acaatgataccgtactatcctcttcattagagtgatttaattgatctataaagggttatatggtt 32424216  T
Q  201 gttggaatttacagctaggag 221  Q
    |||||||||||||||||||||    
T  32424215 gttggaatttacagctaggag 32424195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University