View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13964_low_11 (Length: 245)

Name: NF13964_low_11
Description: NF13964
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13964_low_11
NF13964_low_11
[»] chr4 (1 HSPs)
chr4 (19-231)||(32914420-32914632)


Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 19 - 231
Target Start/End: Complemental strand, 32914632 - 32914420
Alignment:
Q  19 attaagtaatatgggtaattaatatagcacaaaccatcatattgaaatttttagtgcacgcacatgcccctgcacaacttgttgtagatccatccatgaa 118  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
T  32914632 attaagtaatatgggtaattaatatagcacaaaccatcatattgaaatttttagtgcatgcacatgcccctgcacaacttgttgtagatccatccatgaa 32914533  T
Q  119 attggtaagtttgttgtttctcatactacaatttattgaatagttgttctttgtattattcattatcttcaaaacaatcaattttagagttttattttct 218  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32914532 attggtaagtttgtcgtttctcatactacaatttattgaatagttgttctttgtattattcattatcttcaaaacaatcaattttagagttttattttct 32914433  T
Q  219 ctcatattcttct 231  Q
    |||||||||||||    
T  32914432 ctcatattcttct 32914420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University