View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13960_low_22 (Length: 226)

Name: NF13960_low_22
Description: NF13960
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13960_low_22
NF13960_low_22
[»] chr1 (1 HSPs)
chr1 (17-211)||(11399816-11399996)


Alignment Details
Target: chr1 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 17 - 211
Target Start/End: Original strand, 11399816 - 11399996
Alignment:
Q  17 attctccagaccaaaacagaaattttcaaaggaattatagggttccaaannnnnnnatgcgccagtgttaccaatttctaaagaggaagttctagtcaat 116  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||    
T  11399816 attctccagaccaaaacagaaattttcaaaggaattatagggttccaaatttttttatgcgccagtgttaccaatttctaaagaggaagttctagtcaat 11399915  T
Q  117 tttttgtaattgtctctcaccgagcactctctaccacacctatcactccaaatctctttccaccaaagtgatttgcaaatcccccttctgctctc 211  Q
    ||||     || |||||||||| |||||||         ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  11399916 tttt-----ttatctctcaccgtgcactct---------ctatcactccaaatctctttccaccaaagtgatttgcaaatcccccttctgctctc 11399996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University