View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1395_low_29 (Length: 251)

Name: NF1395_low_29
Description: NF1395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1395_low_29
NF1395_low_29
[»] chr4 (1 HSPs)
chr4 (123-251)||(5980174-5980302)


Alignment Details
Target: chr4 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 123 - 251
Target Start/End: Original strand, 5980174 - 5980302
Alignment:
Q  123 catccatatctcaaagcacaaagaagatcataaaaatgtgtgaatatacaatttaagtggcgattttgataagactgactataagcattacaagttgaat 222  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  5980174 catccatatctcaaagcacaaagaagatcataaaaatgtgtgattatacaatttaagtggcgattttgataagactgactataagcattacaagttgaat 5980273  T
Q  223 taaactgtaattgatttttcttatcctca 251  Q
    |||| ||||||||||||||||||||||||    
T  5980274 taaattgtaattgatttttcttatcctca 5980302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University