View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13947_low_9 (Length: 322)

Name: NF13947_low_9
Description: NF13947
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13947_low_9
NF13947_low_9
[»] chr3 (2 HSPs)
chr3 (162-302)||(47563131-47563271)
chr3 (16-69)||(47563372-47563425)
[»] chr1 (1 HSPs)
chr1 (178-280)||(5156721-5156823)


Alignment Details
Target: chr3 (Bit Score: 141; Significance: 6e-74; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 162 - 302
Target Start/End: Complemental strand, 47563271 - 47563131
Alignment:
Q  162 acaaaacatggggttgtgctttggttgcttcgacggaggcaacaagcgtatgacaaaggaggaagaaagattagcctctgaagaagcacgcgctagagct 261  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  47563271 acaaaacatggggttgtgctttggttgcttcgacggaggcaacaagcgtatgacaaaggaggaagaaagattagcctctgaagaagcacgcgctagagct 47563172  T
Q  262 gctgaagccgcccagaaaaagtatgtttccttagtaatttt 302  Q
    |||||||||||||||||||||||||||||||||||||||||    
T  47563171 gctgaagccgcccagaaaaagtatgtttccttagtaatttt 47563131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 16 - 69
Target Start/End: Complemental strand, 47563425 - 47563372
Alignment:
Q  16 atagaagggaagaaaaactccaacgaaaaagggaaggatacggttttcttgttc 69  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
T  47563425 atagaagggaagaaaaactccaacgaaaaagggaaggatacagttttcttgttc 47563372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 178 - 280
Target Start/End: Original strand, 5156721 - 5156823
Alignment:
Q  178 tgctttggttgcttcgacggaggcaacaagcgtatgacaaaggaggaagaaagattagcctctgaagaagcacgcgctagagctgctgaagccgcccaga 277  Q
    ||||||||||||||||  || ||  ||||||| ||||| || || |||||| ||||||||||||||||||| || |||||||||||||||||||| ||||    
T  5156721 tgctttggttgcttcggtggtggtgacaagcgcatgaccaaagaagaagaacgattagcctctgaagaagcgcgtgctagagctgctgaagccgctcaga 5156820  T
Q  278 aaa 280  Q
    |||    
T  5156821 aaa 5156823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University