View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13945_low_21 (Length: 217)

Name: NF13945_low_21
Description: NF13945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13945_low_21
NF13945_low_21
[»] chr1 (1 HSPs)
chr1 (19-199)||(48535724-48535904)


Alignment Details
Target: chr1 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 19 - 199
Target Start/End: Complemental strand, 48535904 - 48535724
Alignment:
Q  19 aaaatttatgttcctttaggttctgtgagagggctcaagcactactacaggcagatctacacactagttcggtcatggttactcacgaattaactcaagt 118  Q
    ||||||||||||| || |||||||||||||||||||| |||||| |||| | ||||||||||||| |||| || |||||||| |  |||| |||||||||    
T  48535904 aaaatttatgttcattcaggttctgtgagagggctcaggcactaatacatggagatctacacactggttctgtgatggttacacgtgaatcaactcaagt 48535805  T
Q  119 tattgatcctgaatttgcattttatggaccaatgggttttgatattggagcattccttggtaacttgatattggctttctt 199  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| || |||||||| |||||||||||    
T  48535804 tattgatcctgaatttgcattttatggaccaatgggttttgatatcggagcattcctaggaaacttgattttggctttctt 48535724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University