View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13938_high_28 (Length: 303)

Name: NF13938_high_28
Description: NF13938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13938_high_28
NF13938_high_28
[»] chr1 (1 HSPs)
chr1 (1-291)||(41567227-41567520)


Alignment Details
Target: chr1 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 1 - 291
Target Start/End: Original strand, 41567227 - 41567520
Alignment:
Q  1 tcttctcttcccaccaccaccgccgcgcctttcatctctctc--gccactgtcgctcctctcactttccccgcccgccgccaccattccaccgcttgcaa 98  Q
    ||||||||||||||||||||| || |||||||| ||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41567227 tcttctcttcccaccaccaccaccacgcctttcgtctctctcacgccactgtcgctcctctcactttccccgcccgccgccaccattccaccgcttgcaa 41567326  T
Q  99 caacctccaaatctcaaccggcggtggagctgcttcgatatggcacgcgattactccttgcggcggcgacggattccgaaccggcggtgtgatgcttcat 198  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41567327 caacctccaaatctcaaccggcggtggagctgcttcgatatggcacgcgattactccttgcggcggcgacggattccgaaccggcggtgtgatgcttcat 41567426  T
Q  199 catgaccacgaactcaaaggtgaaggatcgt-gaacgttgcttgggatgctcgtcctgctagatggcttcatcgttccgactccgcgtggcttc 291  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
T  41567427 catgaccacgaactcaaaggtgaaggatcgtggaacgttgcttgggatgctcgtcctgctagatggcttcatcgttccgactccgcttggcttc 41567520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University