View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13926_high_58 (Length: 219)

Name: NF13926_high_58
Description: NF13926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13926_high_58
NF13926_high_58
[»] chr1 (1 HSPs)
chr1 (16-204)||(26973311-26973499)


Alignment Details
Target: chr1 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 16 - 204
Target Start/End: Original strand, 26973311 - 26973499
Alignment:
Q  16 caaagaaagctaaaatcggacgtttagatgctgacggtccaccgagaaaaccgttgattgaacctgtttggagattgatttcagggaatgaaacatcttt 115  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  26973311 caaagaaagctaaaatcggacgtttagatgctgacagtccaccgagaaaaccgttgattgaacctgtttggagattgatttcagggaatgaaacatcttt 26973410  T
Q  116 tgcagggttgaatctttccgaggtgttggcattgcatagcacgcggatggagttcttgtgtaggtatggtacggagaatgaagtctctg 204  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  26973411 tgcagggttgaatctttctgaggtgttggcattgcatagcacgcggatggagttcttgtgtaggtatggtacggagaatgaagtctctg 26973499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University