View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1391_high_5 (Length: 277)

Name: NF1391_high_5
Description: NF1391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1391_high_5
NF1391_high_5
[»] chr7 (1 HSPs)
chr7 (31-164)||(45801264-45801397)


Alignment Details
Target: chr7 (Bit Score: 134; Significance: 8e-70; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 31 - 164
Target Start/End: Original strand, 45801264 - 45801397
Alignment:
Q  31 cataggcggagatggaaacgggaccacaatagttcatacgaacaagtgctgaactgatattctgcgcaattgcatgtggatcggagcctttaggaacatg 130  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  45801264 cataggcggagatggaaacgggaccacaatagttcatacgaacaagtgctgaactgatattctgcgcaattgcatgtggatcggagcctttaggaacatg 45801363  T
Q  131 acagttctctatatcccaccataccgatatcttc 164  Q
    ||||||||||||||||||||||||||||||||||    
T  45801364 acagttctctatatcccaccataccgatatcttc 45801397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University