View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13912_low_23 (Length: 410)

Name: NF13912_low_23
Description: NF13912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13912_low_23
NF13912_low_23
[»] chr1 (3 HSPs)
chr1 (7-407)||(6457953-6458352)
chr1 (326-388)||(3073985-3074049)
chr1 (374-406)||(30626560-30626592)
[»] chr2 (1 HSPs)
chr2 (288-406)||(33276166-33276286)
[»] chr8 (2 HSPs)
chr8 (290-408)||(4331441-4331561)
chr8 (326-373)||(28993070-28993117)
[»] chr5 (1 HSPs)
chr5 (286-374)||(14852330-14852418)
[»] chr6 (1 HSPs)
chr6 (375-406)||(2987752-2987783)
[»] chr3 (1 HSPs)
chr3 (374-407)||(40413560-40413593)


Alignment Details
Target: chr1 (Bit Score: 299; Significance: 1e-168; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 7 - 407
Target Start/End: Original strand, 6457953 - 6458352
Alignment:
Q  7 aaaccaacaattacgtccccttaccattcaaatattttacaatttaatcttttttgttaactttccatccaatttaaaataatctttgttatataatgtt 106  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  6457953 aaaccaacaattacgtccccttatcattcaaatattttacaatttaatcttttttgttaactttccatccaatttaaaataatctttgttatataatgtt 6458052  T
Q  107 tttatgaccaaaataacattgtcaaacaaaatgcactaacatctattaccnnnnnnnnnnnnnnnctcttctgatcgatccttttagnnnnnnntaggtt 206  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||               ||||||||||||||||||||||       ||||||    
T  6458053 tttatgaccaaaataacattttcaaacaaaatgcactaacatctattaccaaaaaaaaaaaaaatctcttctgatcgatccttttagaaaaaaataggtt 6458152  T
Q  207 tcacatggaggcaatcctattaaaccattaaaccacggtctcatgttttagtattcaatcaaattaaggtttcggtggtggatatgtgcgatttggggtg 306  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||| |||||||||||    
T  6458153 tcacatggaggcaatcctattaaaccattaaaccacggtctcattttttagtattcaatcaaattaaggttt-ggtggtggatatgtgtgatttggggtg 6458251  T
Q  307 ggaggaaggagggatggcctggcaatggcgtcgtcggttgtggacttgggaggaggagctgttaggggtgtaggattttacttcacgatatttctttgca 406  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||    
T  6458252 ggagaaaggagggatggcctggcaatggcgtcgtcggttgtggacttgggagaaggagctgttaggggtgtaggattttacttcacgatatttccttgca 6458351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 326 - 388
Target Start/End: Complemental strand, 3074049 - 3073985
Alignment:
Q  326 tggcaatggcgtcgtcggttgtggacttgggaggaggagctgttaggg--gtgtaggattttact 388  Q
    |||||||||||| | ||||||||| | |||||||||||| ||||||||  |||||||||||||||    
T  3074049 tggcaatggcgtaggcggttgtgggcctgggaggaggagttgttaggggagtgtaggattttact 3073985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 374 - 406
Target Start/End: Complemental strand, 30626592 - 30626560
Alignment:
Q  374 gtgtaggattttacttcacgatatttctttgca 406  Q
    |||| ||||||||||||||||||||||||||||    
T  30626592 gtgttggattttacttcacgatatttctttgca 30626560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 46; Significance: 4e-17; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 288 - 406
Target Start/End: Original strand, 33276166 - 33276286
Alignment:
Q  288 atatgtgcgatttggggtgggaggaaggagggatggcctggcaatggcgtcgtcggttgtggacttgggaggaggagctgtt--aggggtgtaggatttt 385  Q
    ||||||| | ||| |||||||||||||||||   ||| ||||| |||||||||||||||| | | |||||||||||  ||||  ||| |||||||| |||    
T  33276166 atatgtgtggtttagggtgggaggaaggaggtgcggcttggcagtggcgtcgtcggttgtaggcatgggaggaggaattgttaaaggagtgtaggacttt 33276265  T
Q  386 acttcacgatatttctttgca 406  Q
    |||||| ||||||||||||||    
T  33276266 acttcatgatatttctttgca 33276286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 38; Significance: 0.000000000002; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 290 - 408
Target Start/End: Complemental strand, 4331561 - 4331441
Alignment:
Q  290 atgtgcgatttggggtgggaggaaggagggatggcctggcaatggcgtcgtcggttgtggacttgggaggaggagctgttaggg--gtgtaggattttac 387  Q
    |||||||||||||| ||||||||||||||| |||| ||||| ||| |  | ||||||||| | || ||||||||| ||||||||  ||| | || |||||    
T  4331561 atgtgcgatttgggatgggaggaaggaggggtggcttggcagtggtggtggcggttgtgggcgtgagaggaggagatgttaggggagtgaatgactttac 4331462  T
Q  388 ttcacgatatttctttgcaga 408  Q
    || | |||||| |||||||||    
T  4331461 tttatgatattactttgcaga 4331441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 326 - 373
Target Start/End: Original strand, 28993070 - 28993117
Alignment:
Q  326 tggcaatggcgtcgtcggttgtggacttgggaggaggagctgttaggg 373  Q
    ||||| |||||||| |||||||||||||||||||||||| ||||||||    
T  28993070 tggcagtggcgtcggcggttgtggacttgggaggaggagttgttaggg 28993117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 286 - 374
Target Start/End: Original strand, 14852330 - 14852418
Alignment:
Q  286 ggatatgtgcgatttggggtgggaggaaggagggatggcctggcaatggcgtcgtcggttgtggacttgggaggaggagctgttagggg 374  Q
    ||||||||||| ||| ||||||||||| || |||  ||| ||||| ||||| || |||||||||  | |||||||||| ||||||||||    
T  14852330 ggatatgtgcggtttagggtgggaggatggtggggcggcttggcagtggcgccgccggttgtgggttggggaggaggaactgttagggg 14852418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 375 - 406
Target Start/End: Original strand, 2987752 - 2987783
Alignment:
Q  375 tgtaggattttacttcacgatatttctttgca 406  Q
    ||||||||||||||||||||||||||||||||    
T  2987752 tgtaggattttacttcacgatatttctttgca 2987783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 374 - 407
Target Start/End: Original strand, 40413560 - 40413593
Alignment:
Q  374 gtgtaggattttacttcacgatatttctttgcag 407  Q
    |||||| |||||||||||||||||||||||||||    
T  40413560 gtgtagaattttacttcacgatatttctttgcag 40413593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University