View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1390_low_138 (Length: 269)

Name: NF1390_low_138
Description: NF1390
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1390_low_138
NF1390_low_138
[»] chr7 (1 HSPs)
chr7 (29-257)||(34770816-34771044)
[»] chr2 (1 HSPs)
chr2 (37-83)||(8780692-8780738)


Alignment Details
Target: chr7 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 29 - 257
Target Start/End: Complemental strand, 34771044 - 34770816
Alignment:
Q  29 ctaccaagtaatgatggggaagccaatgatcaacttcttaaatacataagttgttgcagtcgcatgtaacgaaggggccacaaccgtaacaattatgtaa 128  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||    
T  34771044 ctaccaagtaatgatggggaagccaatgatcaacttcttaaatacataagttgttgcagtcgcctgtaacgaagggtccacaaccgtaacaattatgtaa 34770945  T
Q  129 attcatattttatgggttttcttttggcacttgatcaatcattgtgtagttgttacttactaggtgtctacttatgtatttgcacacaaattgtaataca 228  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  34770944 attcatattttatgggctttcttttggcacttgatcaatcattgtgtagttgttacttactaggtgtctacttatgtatttgcacacaaattgtaataca 34770845  T
Q  229 ttggctatattgttgtaataccttgcctt 257  Q
    |||||||||||||||||||||||||||||    
T  34770844 ttggctatattgttgtaataccttgcctt 34770816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 37 - 83
Target Start/End: Original strand, 8780692 - 8780738
Alignment:
Q  37 taatgatggggaagccaatgatcaacttcttaaatacataagttgtt 83  Q
    |||||||| |||| ||||||||||||||||||| || ||||||||||    
T  8780692 taatgatgaggaaaccaatgatcaacttcttaattatataagttgtt 8780738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University