View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13900_low_34 (Length: 243)

Name: NF13900_low_34
Description: NF13900
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13900_low_34
NF13900_low_34
[»] chr2 (1 HSPs)
chr2 (1-236)||(34911409-34911643)


Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 34911409 - 34911643
Alignment:
Q  1 tgtgaatttctatgataaaatatttaaattattagaatttttatgtatagtacctcattgagagagcttgccaacttttagaaaatctcaccactatcgg 100  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
T  34911409 tgtgaatttctatgagaaaatatttaaattattagaatttttatgtatagtacctcattgagagagcttgccaacttttagaaaatctcaccactaccgg 34911508  T
Q  101 cgaagttgacgatatgtagatctcaattttcatagccaaaacctcgtggattccgaggatgttgcggtgagtaggaaggtagtggataagtttgattttg 200  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||| |||||||||||||||||    
T  34911509 cgaagttgacgatatgcagatctcaattttcatagccaaaacctcgtggattccgaggatgttgcggtgagtagg-agataggggataagtttgattttg 34911607  T
Q  201 caaatgatttactgctccattgatgcgtccatcgtt 236  Q
    ||||||||||||||||||||||||||||||||||||    
T  34911608 caaatgatttactgctccattgatgcgtccatcgtt 34911643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University