View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1389_low_51 (Length: 205)

Name: NF1389_low_51
Description: NF1389
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1389_low_51
NF1389_low_51
[»] chr1 (1 HSPs)
chr1 (30-192)||(8248332-8248493)
[»] chr5 (1 HSPs)
chr5 (150-183)||(119366-119399)


Alignment Details
Target: chr1 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 30 - 192
Target Start/End: Complemental strand, 8248493 - 8248332
Alignment:
Q  30 gagaaggtggtgtcgtagttaaactgagtgacaagtgcggtggtggaagtgaaacgtgaaaaattctgagaaagaatttgaatagaaaatcatgaaaata 129  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
T  8248493 gagaaggtggtgtcgtagtgaaactgagtgacaagtgcggtggtggaagtgaaacgtgaaaaattctgagaaagaatttgaatagaaaatcatgaaatta 8248394  T
Q  130 cccccctcaatttctgctggaaaatcaattatgtccctgcactttaatggaaatcatgaattt 192  Q
     ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  8248393 -ccccctcaatttctgctggaaaatcaattatgtccctgcactttaatggaaatcatgaattt 8248332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 150 - 183
Target Start/End: Complemental strand, 119399 - 119366
Alignment:
Q  150 aaaatcaattatgtccctgcactttaatggaaat 183  Q
    |||||||||||||||||||||||||| |||||||    
T  119399 aaaatcaattatgtccctgcactttattggaaat 119366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University