View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13881_high_16 (Length: 293)

Name: NF13881_high_16
Description: NF13881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13881_high_16
NF13881_high_16
[»] chr5 (2 HSPs)
chr5 (1-154)||(12351174-12351327)
chr5 (203-287)||(12351376-12351460)
[»] chr3 (1 HSPs)
chr3 (245-278)||(30127181-30127214)


Alignment Details
Target: chr5 (Bit Score: 134; Significance: 9e-70; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 134; E-Value: 9e-70
Query Start/End: Original strand, 1 - 154
Target Start/End: Original strand, 12351174 - 12351327
Alignment:
Q  1 cacttggttgagttttgtaaccattaacaatgcaggttgttggtattggtgtcataaggtgactatgatgtgggtggttgttggtgtcggtaatacatgg 100  Q
    |||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
T  12351174 cacttggttgcgttttgtaaccattaacaatggaggttgttggtattggtgtcataaggtgactatgatgtgggtggttgttggtgtcagtaatacatgg 12351273  T
Q  101 tggtaattgttggtgttaggttgggagttggaacattaaggatgataatgagga 154  Q
    |||| ||||||||||||||| |||||||||||||||||||||||||||||||||    
T  12351274 tggtgattgttggtgttaggctgggagttggaacattaaggatgataatgagga 12351327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 203 - 287
Target Start/End: Original strand, 12351376 - 12351460
Alignment:
Q  203 tgtctacttgtggtgacctcagatttgggtccatctcgtcgaaagttagtgtctagtttcaagtttttgggttggtgatgatgtc 287  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||    
T  12351376 tgtctacttgtgctgacctcagatttgggtccatctcgtcgaaagttagtgtctagtttcaagtttttgggttggttatggtgtc 12351460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 245 - 278
Target Start/End: Original strand, 30127181 - 30127214
Alignment:
Q  245 aagttagtgtctagtttcaagtttttgggttggt 278  Q
    ||||||||||||||||||||||||||||||||||    
T  30127181 aagttagtgtctagtttcaagtttttgggttggt 30127214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University