View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1388-INSERTION-2 (Length: 114)

Name: NF1388-INSERTION-2
Description: NF1388
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1388-INSERTION-2
NF1388-INSERTION-2
[»] chr2 (1 HSPs)
chr2 (7-110)||(39560307-39560410)


Alignment Details
Target: chr2 (Bit Score: 104; Significance: 2e-52; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 104; E-Value: 2e-52
Query Start/End: Original strand, 7 - 110
Target Start/End: Original strand, 39560307 - 39560410
Alignment:
Q  7 atatatttactcagcaatttgtaagatcctagtctaaactcattatataaccgttggttatgccttggtctatgttgcattcgaatacaagtcatataag 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  39560307 atatatttactcagcaatttgtaagatcctagtctaaactcattatataaccgttggttatgccttggtctatgttgcattcgaatacaagtcatataag 39560406  T
Q  107 tata 110  Q
    ||||    
T  39560407 tata 39560410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University