View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13866_low_26 (Length: 251)

Name: NF13866_low_26
Description: NF13866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13866_low_26
NF13866_low_26
[»] chr4 (2 HSPs)
chr4 (18-108)||(40984992-40985082)
chr4 (127-162)||(40984947-40984982)


Alignment Details
Target: chr4 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 18 - 108
Target Start/End: Complemental strand, 40985082 - 40984992
Alignment:
Q  18 agaaggaacatcccctaacgttattaatcatttctctttacaacctcctcaaccttctcaaattattcatctttctcaactccataatcat 108  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40985082 agaaggaacatcccctaacgttattaatcatttctctttacaacctcctcaaccttctcaaattattcatctttctcaactccataatcat 40984992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 127 - 162
Target Start/End: Complemental strand, 40984982 - 40984947
Alignment:
Q  127 aatgtctccactggccttcgtttatcatttgatgat 162  Q
    ||||||||||||||||||||||||||||||||||||    
T  40984982 aatgtctccactggccttcgtttatcatttgatgat 40984947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University