View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13866_low_17 (Length: 325)

Name: NF13866_low_17
Description: NF13866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13866_low_17
NF13866_low_17
[»] chr2 (1 HSPs)
chr2 (1-317)||(21235195-21235511)


Alignment Details
Target: chr2 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 1 - 317
Target Start/End: Complemental strand, 21235511 - 21235195
Alignment:
Q  1 gttccagtttgaggacgtccgccgtgtctggttcggaagttgttaagaagccgttgagtaagccggctttgtcgagggatagagttggttcttccacagt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  21235511 gttccagtttgaggacgtccgccgtgtctggttcggaagttgttaagaagccgttgagtaagccggctttgtcgagggatagagttggttcttccacagt 21235412  T
Q  101 ggatggttccgttaggaagaccgtggggaaggtttcgtcgccgtcattgtcggcgcggtcaccaactgtttctggtggattgagggcggggtctgtgtca 200  Q
    ||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  21235411 ggatggttccgttaggaagactgtggggaaggtttcgtcgcagtcattgtcggcgcggtcaccaactgtttctggtggattgagggcggggtctgtgtca 21235312  T
Q  201 tcttcttcggatagaagttctggtttgtctggaaggaggaaagtgacgacgacccctgacagtcgtaactcgcggttaattgttcttccgcagattgagg 300  Q
    || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
T  21235311 tcgtcttcggatagaagttctggtttgtctggaaggaggaaagtgacgacgacccctgatagtcgtaactcgcggttaattgttcttccgcagattgagg 21235212  T
Q  301 ttaaagctagtgatgat 317  Q
    |||||||||||||||||    
T  21235211 ttaaagctagtgatgat 21235195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University