View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13860_low_35 (Length: 224)

Name: NF13860_low_35
Description: NF13860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13860_low_35
NF13860_low_35
[»] chr3 (1 HSPs)
chr3 (1-212)||(53617069-53617280)


Alignment Details
Target: chr3 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 53617069 - 53617280
Alignment:
Q  1 ccggcgttattcccggtcctgataggtttgcggttcaggattcgtattttccggttcggcgaggaggatcggtgacgctgtatcaagatgcacacgttcc 100  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  53617069 ccggtgttattcccggtcctgataggtttgcggttcaggattcgtattttccggttcggcgaggaggatcggtgacgctgtatcaagatgcacacgttcc 53617168  T
Q  101 ggattcgatgttaccggagattgaattggatgatggtgttgagtttcagcaggggaaatgttgggaagatatttgtcacgcaatattagaagcgcatcat 200  Q
     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  53617169 agattcgatgttaccggagattgaattggatgatggtgttgagtttcagcaggggaaatgttgggaagatatttgtcacgcaatattagaagcgcatcat 53617268  T
Q  201 ttggtgtatatt 212  Q
    ||||||||||||    
T  53617269 ttggtgtatatt 53617280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University