View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13851_low_19 (Length: 235)

Name: NF13851_low_19
Description: NF13851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13851_low_19
NF13851_low_19
[»] chr5 (1 HSPs)
chr5 (1-139)||(29932163-29932301)


Alignment Details
Target: chr5 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 1 - 139
Target Start/End: Original strand, 29932163 - 29932301
Alignment:
Q  1 ctcaacacactcgttcctagtgggaataggctatggtaatttagcgtccagtccaaaagtaagtaaattctagtaaaaagttgttctagtcagaatcgaa 100  Q
    |||||||| ||||||||||| ||||||||||||||||||||||| || | ||||||||||||||||||||||||||||||||||||||||||||||||||    
T  29932163 ctcaacactctcgttcctagcgggaataggctatggtaatttagtgttcggtccaaaagtaagtaaattctagtaaaaagttgttctagtcagaatcgaa 29932262  T
Q  101 acaagtgaatcaataaattaccactaagaataaattttg 139  Q
    |||||||||||||||| ||||||||||||||||||||||    
T  29932263 acaagtgaatcaataagttaccactaagaataaattttg 29932301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University