View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13849_high_26 (Length: 253)

Name: NF13849_high_26
Description: NF13849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13849_high_26
NF13849_high_26
[»] chr1 (2 HSPs)
chr1 (117-246)||(5867597-5867726)
chr1 (18-77)||(5867721-5867780)


Alignment Details
Target: chr1 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 117 - 246
Target Start/End: Complemental strand, 5867726 - 5867597
Alignment:
Q  117 ttgcaatcatagataattgtaatcaaaattgcaatttcaaccttaaagtaactacaaccgtaatcagaacaatgcaactttagatgattcatgataaaat 216  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||| ||||||||||||||    
T  5867726 ttgcaatcatagataattgtaatcaaaattgcaatttcaaccttaaagaaactacagccgtaatcagaacaatgcaactttagataattcatgataaaat 5867627  T
Q  217 tgaatcaaattgaattgaaattaacctttg 246  Q
    ||||||||||||||||||||||||||||||    
T  5867626 tgaatcaaattgaattgaaattaacctttg 5867597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 18 - 77
Target Start/End: Complemental strand, 5867780 - 5867721
Alignment:
Q  18 cttaatataatgaaaaactatagttaattacagccaatgcatcagtaactacaattgcaa 77  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  5867780 cttaatataatgaaaaactatagttaattacagccaatgcatcagtaactacaattgcaa 5867721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University