View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13845_low_6 (Length: 246)

Name: NF13845_low_6
Description: NF13845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13845_low_6
NF13845_low_6
[»] chr2 (1 HSPs)
chr2 (1-246)||(45671591-45671840)


Alignment Details
Target: chr2 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 45671840 - 45671591
Alignment:
Q  1 tcatcatgtcatggctgccagtgctgttgaacttcttactgacttggtcaaggctttacaggcagtcaatgctactgcatggcacaatgcttttttaggt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  45671840 tcatcatgtcatggctgccagtgctgttgaacttcttactgacttggtcaaggctttacaggcagtcaatgctactgcatggcacaatgcttttttaggt 45671741  T
Q  101 ttatggtttgctgccctgcgactcgttcaaagggtaagaaatactaac----ttcagccaattgattaactcaaatatgttctggttgctcatttatgtg 196  Q
    |||||||||||||||||||| ||||||||| |||||||||||||||||    |||||||||||||||||||||||| |||||||||||||||||||||||    
T  45671740 ttatggtttgctgccctgcggctcgttcaacgggtaagaaatactaacttgtttcagccaattgattaactcaaatctgttctggttgctcatttatgtg 45671641  T
Q  197 ccagacactgcattgtccacgagcttacaaatgtgtaacatgtggtcaaa 246  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
T  45671640 ccagacactgcattgtccacgagcttacaaatgtgtaacatgtggtcaaa 45671591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University