View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13841_low_28 (Length: 235)

Name: NF13841_low_28
Description: NF13841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13841_low_28
NF13841_low_28
[»] chr1 (2 HSPs)
chr1 (128-228)||(27685017-27685117)
chr1 (1-73)||(27685192-27685264)


Alignment Details
Target: chr1 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 128 - 228
Target Start/End: Complemental strand, 27685117 - 27685017
Alignment:
Q  128 gtatgaaatgctcaaattaaacaagcatatgttcgtatgaaatgctcaaattaatcggttagactttatttttgggctagtagagcatatagggtagcca 227  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  27685117 gtatgaaatgctcaaattaaacaagcatatgttcgtatgaaatgctcaaattaatcggttagactttatttttgggctagtagagcatatagggtagcca 27685018  T
Q  228 a 228  Q
    |    
T  27685017 a 27685017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 27685264 - 27685192
Alignment:
Q  1 tgcacaaaaagtttatcacgtttaagatattatttttcacttttgtatttataacaattaaaataaccacaag 73  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  27685264 tgcacaaaaagtttatcacgtttaagatattatttttcacttttgtatttataacaattgaaataaccacaag 27685192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University