View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13841_high_23 (Length: 266)

Name: NF13841_high_23
Description: NF13841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13841_high_23
NF13841_high_23
[»] chr4 (2 HSPs)
chr4 (111-253)||(52268487-52268629)
chr4 (144-179)||(52268641-52268676)
[»] chr5 (2 HSPs)
chr5 (73-253)||(13745516-13745694)
chr5 (4-71)||(13745499-13745566)


Alignment Details
Target: chr4 (Bit Score: 139; Significance: 8e-73; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 111 - 253
Target Start/End: Complemental strand, 52268629 - 52268487
Alignment:
Q  111 tagtcggctgatagcatattgggaatacctacactcaaggtgggattgtacctggtgttggcgctagatttgttaagaacaatgttattttcttgccttg 210  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  52268629 tagtcggctgatagcatattgggaatacctactctcaaggtgggattgtacctggtgttggcgctagatttgttaagaacaatgttattttcttgccttg 52268530  T
Q  211 tttgagggaaaagcatgataacccatatatggatgtagtaagt 253  Q
    |||||||||||||||||||||||||||||||||||||||||||    
T  52268529 tttgagggaaaagcatgataacccatatatggatgtagtaagt 52268487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 144 - 179
Target Start/End: Complemental strand, 52268676 - 52268641
Alignment:
Q  144 ctcaaggtgggattgtacctggtgttggcgctagat 179  Q
    ||||||||||||||||||||||||||||||||||||    
T  52268676 ctcaaggtgggattgtacctggtgttggcgctagat 52268641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 94; Significance: 6e-46; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 73 - 253
Target Start/End: Original strand, 13745516 - 13745694
Alignment:
Q  73 cctgttaaccatgatctttttcctggaaggtagtcacatagtcggctgatagcatattgggaatacctacactcaaggtgggattgtacctggtgttggc 172  Q
    |||||||| || ||||||||| | ||||||||||||| ||||||||||||| |||||||||||| ||||| |||||||||  |||||||| |||||||||    
T  13745516 cctgttaatcaggatcttttttccggaaggtagtcacttagtcggctgataccatattgggaatgcctactctcaaggtg--attgtaccaggtgttggc 13745613  T
Q  173 gctagatttgttaagaacaatgttattttcttgccttgtttgagggaaaagcatgataacccatatatggatgtagtaagt 253  Q
    |||||||| |||||||||  |||||||| |||||||||||||||||||||||| || |||| || ||| ||| ||||||||    
T  13745614 gctagattggttaagaactgtgttatttccttgccttgtttgagggaaaagcaagagaacctatttatagatatagtaagt 13745694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 4 - 71
Target Start/End: Original strand, 13745499 - 13745566
Alignment:
Q  4 gatgaagtgttgcataacctgttaaccaggatctttttcccggaaggtagtcacatagtctgctgata 71  Q
    |||||| |||||||||||||||||| |||||||||||| ||||||||||||||| ||||| |||||||    
T  13745499 gatgaaatgttgcataacctgttaatcaggatcttttttccggaaggtagtcacttagtcggctgata 13745566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University